MultiEdit PTG Designer 2.0

Polycistronic tRNA-gRNA Assembly Platform for CRISPR Multiplex Gene Editing

Max 9x Spacers 12 Different IIs Restriction Sites Internal Recognition Site Flagging Wet Lab Validated

Golden Gate Assembly

BsaI & FokI-based precision module (default, and 11 others) joining for seamless PTG construct design

PTG Multiplexing

Design up to 9 simultaneous gene targets within a single polycistronic cassette

Export Ready

Complete primers, modules & assembly sequences ready for immediate synthesis

About the Platform

MultiEdit PTG Designer 2.0 is a web-based bioinformatics tool developed at ICAR-IARI for the automated design of Polycistronic tRNA-gRNA (PTG) constructs used in CRISPR-Cas9 multiplex gene editing. The platform streamlines the process of designing multiple spacer sequences, generating module-specific primers, and assembling complete PTG cassettes using the Golden Gate cloning strategy — enabling researchers to target up to 9 genes simultaneously in a single construct.

Golden Gate Assembly Design

BsaI- and FokI-based precision module joining with automatically generated overhangs and primers for seamless ligation-independent cloning.
Wet Lab Validated

All design rules and template sequences have been experimentally validated through bench-top CRISPR editing experiments, ensuring high construct fidelity.
Plant Compatible

Optimised for both monocot (rice, wheat, maize) and dicot (tomato, soybean) plant species using established Arabidopsis tRNA spacer architecture.

Launch Tool Documentation

Construction of tandemly arrayed polycistronic tRNA-gRNA (PTG) cassettes and their assembly is schematically depicted. This multiplex editing system utilizes the endogenous tRNA processing system. For PTG assembly construction, gRNA spacer-specific primers (reverse and forward primers anchor last and first 12 nucleotides of the 20 bp spacer, respectively) were designed with 4-bp overlap for Golden Gate (GG) assembly. Each module was PCR-amplified (from a plasmid template that contains plant tRNA sequence followed by 76 bp native or 86 bp engineered gRNA scaffold sequence) and BsaI-digested in order to create 4-bp overhangs that ligate all the modules together in correct orientation for producing the complete gRNA (spacer + scaffold) without any extra nucleotides. This software provides flexibility in choosing N number of spacers and 12 commonly used typeIIs restriction enzymes that provide recognition sequences for 4-bp overhang.

Secondary structure comparison of commonly used (referred as native) versus engineered sgRNA scaffold. Extending the stem of tetra-loop hairpin (by incorporating 10 nucleotides) provides increased stability of sgRNA: Cas9 complex. Removing the premature transcription sequence (by substituting A/T residue to C/G residue in the tetra loop poly-A stretch) reinforced the stable complex between Cas9 and sgRNA.

Template Sequences

Core nucleotide sequences used in PTG assembly

Engineered Scaffold System (Scaffold 2)

Complete Template (163 nt): 86 nt Scaffold + 77 nt tRNA

agcaatgcttttttataatgccaactttgtacaaaaaagcaggctccgcggccgcccccttcaccGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAtggcagaagggtgggcgcgccgacccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgca

gRNA Scaffold 2 (86 nt)

GTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC

tRNA Sequence (77 nt)

AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA

Native Scaffold System (Scaffold 1)

Complete Template (153 nt): 76 nt Scaffold + 77 nt tRNA

agcaatgcttttttataatgccaactttgtacaaaaaagcaggctccgcggccgcccccttcaccGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAtggcagaagggtgggcgcgccgacccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgca

gRNA Scaffold 1 (76 nt)

GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC

tRNA Sequence (77 nt)

AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCA